The detailed information of tRNA gene sequence


Sequence ID>W1710050271
Genome IDBBRI01000002
Search identical group
Phylum/ClassActinobacteria
SpeciesDemequina sp. NBRC 110052 (BBRI)
Start position on genome 1313210
End posion on genome 1313283
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
gtcacggcat
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCCG
Downstream region at tRNA end position
actcgaaggc
Secondary structure (Cloverleaf model)
>W1710050271	Gly	CCC
                   t      TCCG actcgaaggc
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK