The detailed information of tRNA gene sequence


Sequence ID>W1710050356
Genome IDBBRK01000004
Search identical group
Phylum/ClassActinobacteria
SpeciesDemequina sp. NBRC 110054 (BBRK)
Start position on genome 658388
End posion on genome 658461
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
acacggcgct
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCCA
Downstream region at tRNA end position
atcatcatcg
Secondary structure (Cloverleaf model)
>W1710050356	Gly	CCC
                   t      TCCA atcatcatcg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK