The detailed information of tRNA gene sequence


Sequence ID>W1710050401
Genome IDBBRL01000004
Search identical group
Phylum/ClassActinobacteria
SpeciesDemequina sp. NBRC 110055 (BBRL)
Start position on genome 359497
End posion on genome 359570
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
cgtgccgtgc
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCCG
Downstream region at tRNA end position
tgtgtctgag
Secondary structure (Cloverleaf model)
>W1710050401	Gly	CCC
                   c      TCCG tgtgtctgag
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK