The detailed information of tRNA gene sequence


Sequence ID>W1710050491
Genome IDBBRM01000008
Search identical group
Phylum/ClassActinobacteria
SpeciesDemequina sp. NBRC 110056 (BBRM)
Start position on genome 41276
End posion on genome 41203
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
ggcggtgctc
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCCA
Downstream region at tRNA end position
acggaaaggc
Secondary structure (Cloverleaf model)
>W1710050491	Gly	CCC
                   c      TCCA acggaaaggc
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK