The detailed information of tRNA gene sequence


Sequence ID>W1710050499
Genome IDBBRN01000003
Search identical group
Phylum/ClassActinobacteria
SpeciesDemequina sp. NBRC 110057 (BBRN)
Start position on genome 1015436
End posion on genome 1015509
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
ggcgccgcgc
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCCA
Downstream region at tRNA end position
cgtgacacga
Secondary structure (Cloverleaf model)
>W1710050499	Gly	CCC
                   c      TCCA cgtgacacga
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK