The detailed information of tRNA gene sequence


Sequence ID>W1710074216
Genome IDBCYU01000064
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonas asaccharolytica NBRC 15499 (BCYU)
Start position on genome 4289
End posion on genome 4365
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gaccgggcgt
tRNA gene sequence
GGTTCCGTAGCTCAGCTGGACAGAGCGCCACTTTCCTAAAGTGGGCGTCGGGGGTTCGAG
TCCCTCCGGGACCACCA
Downstream region at tRNA end position
tcctgccatc
Secondary structure (Cloverleaf model)
>W1710074216	Arg	CCT
                   t      ACCA tcctgccatc
                     G - C
                     G - C
                     T - A
                     T + G
                     C - G
                     C - G
                     G - C          T G
                    T     C T C C C     A
      C G A        A      | + | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      A C A        G     GCGTC
                    C - G
                    C - G
                    A - T
                    C - G
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK