The detailed information of tRNA gene sequence


Sequence ID>W1710082576
Genome IDBDHH01000006
Search identical group
Phylum/ClassFirmicutes
SpeciesFusibacter sp. 3D3 (BDHH)
Start position on genome 2552
End posion on genome 2628
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
cctaaaattg
tRNA gene sequence
GGGCGTATAGCTCAGCTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTGGTTCGAG
TCCACTTATGCCCACCA
Downstream region at tRNA end position
tgcccggata
Secondary structure (Cloverleaf model)
>W1710082576	Ile	GAT
                   g      ACCA tgcccggata
                     G - C
                     G - C
                     G - C
                     C - G
                     G + T
                     T - A
                     A - T          T G
                    T     T C A C C     A
      C G A        A      + | | | |     G
    T       C T C G       G G T G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    A - T
                    C - G
                    G - C
                    C - G
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK