The detailed information of tRNA gene sequence


Sequence ID>W1710518444
Genome IDFNEA01000003
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus denitrificans (FNEA)
Start position on genome 200652
End posion on genome 200735
Amino Acid Leu
Anticodon CAA
Upstream region at tRNA start position
gcgcagaaag
tRNA gene sequence
GCCCGAGTGGCGGAATGGTAGACGCAGCGGATTCAAAATCCGCCGCCGCAAGGCATGTCG
GTTCGAGTCCGACCTCGGGTACCA
Downstream region at tRNA end position
aatcctggtg
Secondary structure (Cloverleaf model)
>W1710518444	Leu	CAA
                   g      ACCA aatcctggtg
                     G + T
                     C - G
                     C - G
                     C - G
                     G - C
                     A - T
                     G - C          T G
                    T     C A G C C     A
      T A A        G      | | | | |     G
    G       G G C G       G T C G G     C
    G         | | |                 T T
    T       A C G C
      A G          A     CGCCGCAAGGCAT
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  T       A
                  T       A
                    C A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK