The detailed information of tRNA gene sequence


Sequence ID>W1710518463
Genome IDFNEA01000008
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus denitrificans (FNEA)
Start position on genome 121805
End posion on genome 121710
Amino Acid SeC(p)
Anticodon TCA
Upstream region at tRNA start position
tcggggatag
tRNA gene sequence
GGAAGAGAAGCGTCCCCGGTGGGGCGGCCGGACTTCAAATCCGGTTGGGGCAGTGAGCCT
GTCCCGGGTGGGTTCGACTCCCACTCTCTTCCGCCA
Downstream region at tRNA end position
gatgcgacga
Secondary structure (Cloverleaf model)
>W1710518463	SeC(p)	TCA
                   g      GCCA gatgcgacga
                     G - C
                     G - C
                     A - T
                     A - T
                     G - C
                     A - T
                     G - C
                     A - T          T C
                    A     C A C C C     A
      C C C        G      | | | | |     G
    G       C T G C       G T G G G     C
    G       | + | |                 T T
    T       G G C G
      G G          G     TTGGGGCAGTGAGCCTGTCCCGG
                    C - G
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK