The detailed information of tRNA gene sequence


Sequence ID>W1710524249
Genome IDFNIO01000008
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesLutimaribacter pacificus (FNIO)
Start position on genome 56866
End posion on genome 56793
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
gcgcgctccc
tRNA gene sequence
GCGGGTGTAGCTCAATGGTAGAGCCGCAGCTTCCCAAGCTGAAGACGAGGGTTCGATTCC
CTTCACCCGCTCCA
Downstream region at tRNA end position
atcccccacc
Secondary structure (Cloverleaf model)
>W1710524249	Gly	CCC
                   c      TCCA atcccccacc
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T T C C C     A
        A A        A      + | | | |     G
      T     C T C G       G A G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        C     AGAC
                    G   A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK