| Sequence ID | >W1710545685 |
| Genome ID | FOBS01000002 |
| Phylum/Class | Thermodesulfobacteriota |
| Species | Syntrophus gentianae [FOBS] |
| Start position on genome | 82638 |
| End posion on genome | 82563 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
aaatcttaac |
| tRNA gene sequence |
GCCCACGTAGCTCAGTCGGTAGAGCACATCCTTGGTAAGGATGAGGTCACCAGTTCAATC |
| Downstream region at tRNA end position |
atggtgtgca |
| Secondary structure (Cloverleaf model) | >W1710545685 Thr GGT
c TCCA atggtgtgca
G - C
C - G
C - G
C - G
A - T
C - G
G - C C T
T T G G T C A
T G A A | | | | | A
C C T C G A C C A G C
G | | | | T T
G G A G C
T A A AGGTC
C - G
A - T
T - A
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |