The detailed information of tRNA gene sequence


Sequence ID>W1710545688
Genome IDFOBS01000005
Search identical group
Phylum/ClassBacteroidetes
SpeciesSyntrophus gentianae (FOBS)
Start position on genome 134190
End posion on genome 134114
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
ttgctttcat
tRNA gene sequence
GCGCCAGTAGCTCAGCTGGATAGAGCAACGGACTTCTAATCCGTAGGTCCCGGGTTCGAA
TCCCTGCTGGCGTACCA
Downstream region at tRNA end position
tatcttatgg
Secondary structure (Cloverleaf model)
>W1710545688	Arg	TCT
                   t      ACCA tatcttatgg
                     G + T
                     C - G
                     G - C
                     C - G
                     C - G
                     A - T
                     G - C          T A
                    T     G T C C C     A
      C G A        A      |   | | |     G
    T       C T C G       C C G G G     C
    G       | | | |                 T T
    G       G A G C
      A T A        A     AGGTC
                    A - T
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK