The detailed information of tRNA gene sequence


Sequence ID>W1710561073
Genome IDFONW01000001
Search identical group
Phylum/ClassBetaproteobacteria
SpeciesSunxiuqinia elliptica (FONW)
Start position on genome 139331
End posion on genome 139255
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
aaatatttta
tRNA gene sequence
GGGCCTATAGCTCAGTTGGTTAGAGCACCTGACTCATAATCAGGTGGTCCCTGGTTCAAG
CCCAGGTGGGCCCACCA
Downstream region at tRNA end position
aaacaaaagc
Secondary structure (Cloverleaf model)
>W1710561073	Met	CAT
                   a      ACCA aaacaaaagc
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     T + G
                     A - T          C G
                    T     G G A C C     A
      T G A        A      | | | | |     A
    T       C T C G       C C T G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     TGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    A - T
                  C       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK