The detailed information of tRNA gene sequence


Sequence ID>W1710575542
Genome IDFOZG01000001
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonas sp. S5-249 (FOZG)
Start position on genome 449572
End posion on genome 449648
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
aggcatctgt
tRNA gene sequence
GGCGGAGTAGCTCAGTCGGTTAGAGCAGCGGAATCATAATCCGCGTGTCGGGGGTTCGAG
TCCCTCCTCCGCTACCA
Downstream region at tRNA end position
cttgaatagt
Secondary structure (Cloverleaf model)
>W1710575542	Met	CAT
                   t      ACCA cttgaatagt
                     G + T
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     G - C          T G
                    T     C T C C C     A
      T G A        A      | + | | |     G
    C       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     GTGTC
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  A       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK