The detailed information of tRNA gene sequence


Sequence ID>W1710581235
Genome IDFPJZ01000002
Search identical group
Phylum/ClassActinobacteria
SpeciesThermoactinomyces sp. DSM 45891 (FPJZ)
Start position on genome 177574
End posion on genome 177649
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
agcttgttat
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCACCA
Downstream region at tRNA end position
tccaaatcat
Secondary structure (Cloverleaf model)
>W1710581235	Ala	GGC
                   t      ACCA tccaaatcat
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK