The detailed information of tRNA gene sequence


Sequence ID>W1710584828
Genome IDFQVW01000042
Search identical group
Phylum/ClassFirmicutes
SpeciesOrnithinibacillus halophilus (FQVW)
Start position on genome 3992
End posion on genome 4064
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
agggtgtaaa
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCAtat
Downstream region at tRNA end position
agtataaaag
Secondary structure (Cloverleaf model)
>W1710584828	Ala	GGC
                   a      Atat agtataaaag
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK