The detailed information of tRNA gene sequence


Sequence ID>W1710589027
Genome IDFQZU01000041
Search identical group
Phylum/ClassDeltaproteobacteria
SpeciesDesulfatibacillum alkenivorans DSM 16219 (FQZU)
Start position on genome 14687
End posion on genome 14763
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
ctttgggaaT
tRNA gene sequence
GGGCCCATAGCTCAGCTGGAAGAGCCACCGGCTCATAACCGGTAGGTCCCTGGTTCGAAC
CCAGGTGGGCCCATCA
Downstream region at tRNA end position
tcgccctaaa
Secondary structure (Cloverleaf model)
>W1710589027	Met	CAT
                   T      ATCA tcgccctaaa
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T          C A
                    T     G G A C C     A
      C G A        A      | | | | |     G
    T       C T C G       C C T G G     C
    G       | | | |                 T T
    G       G A G C
      A A          C     AGGTC
                    A - T
                    C - G
                    C - G
                    G - C
                    G - C
                  C       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK