The detailed information of tRNA gene sequence


Sequence ID>W1710606636
Genome IDFWXY01000016
Search identical group
Phylum/ClassDeltaproteobacteria
SpeciesDesulfobacterium vacuolatum DSM 3385 (FWXY)
Start position on genome 35199
End posion on genome 35274
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
tatatcttgt
tRNA gene sequence
GGGGCTGTAGCTCAGATGGGAGAGCGCATGACTGGCAGTCATGAGGTCAGGGGTTCGATC
CCCCTCAGCTCCACCA
Downstream region at tRNA end position
caattttgga
Secondary structure (Cloverleaf model)
>W1710606636	Ala	GGC
                   t      ACCA caattttgga
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     T - A
                     G - C          C T
                    T     T C C C C     A
      A G A        A      | | | | |     G
    T       C T C G       A G G G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    A - T
                    T - A
                    G - C
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK