The detailed information of tRNA gene sequence


Sequence ID>W1710608104
Genome IDFXAQ01000001
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus sp. J56 (FXAQ)
Start position on genome 1859
End posion on genome 1776
Amino Acid Leu
Anticodon CAA
Upstream region at tRNA start position
gcaatagttt
tRNA gene sequence
GCCCGAGTGGCGGAATGGTAGACGCAGCGGATTCAAAATCCGCCGCCGCAAGGCATGTCG
GTTCGAGTCCGACCTCGGGTACCA
Downstream region at tRNA end position
attgagatcg
Secondary structure (Cloverleaf model)
>W1710608104	Leu	CAA
                   t      ACCA attgagatcg
                     G + T
                     C - G
                     C - G
                     C - G
                     G - C
                     A - T
                     G - C          T G
                    T     C A G C C     A
      T A A        G      | | | | |     G
    G       G G C G       G T C G G     C
    G         | | |                 T T
    T       A C G C
      A G          A     CGCCGCAAGGCAT
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  T       A
                  T       A
                    C A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK