The detailed information of tRNA gene sequence


Sequence ID>W1710608114
Genome IDFXAQ01000008
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus sp. J56 (FXAQ)
Start position on genome 129055
End posion on genome 129128
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
gcggggcctc
tRNA gene sequence
GCGGGTGTAGCTCAATGGTAGAGCCGCAGCTTCCCAAGCTGAAGACGAGGGTTCGATTCC
CTTCACCCGCTCCA
Downstream region at tRNA end position
accgccctcc
Secondary structure (Cloverleaf model)
>W1710608114	Gly	CCC
                   c      TCCA accgccctcc
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T T C C C     A
        A A        A      + | | | |     G
      T     C T C G       G A G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        C     AGAC
                    G   A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK