The detailed information of tRNA gene sequence


Sequence ID>W1710693973
Genome IDLAGQ01000029
Search identical group
Phylum/Classunclassified bacteria
Speciesbacteria symbiont BFo1 of Frankliniella occidentalis (LAGQ)
Start position on genome 201480
End posion on genome 201406
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gccgctcaaa
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
tttcacagta
Secondary structure (Cloverleaf model)
>W1710693973	Arg	CCT
                   a      ACCA tttcacagta
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK