The detailed information of tRNA gene sequence


Sequence ID>W1710727389
Genome IDLFSO01000034
Search identical group
Phylum/ClassFirmicutes
SpeciesClostridiales bacterium DTU053 (LFSO)
Start position on genome 133316
End posion on genome 133391
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
ggcagtgcgc
tRNA gene sequence
GGGAGCATAGCTCAGCTGGGAGAGCACTTGCCTTACAAGCAAGGGGTCACAGGTTCGAGC
CCTGTTGCTCCCACCA
Downstream region at tRNA end position
ggaagtggcc
Secondary structure (Cloverleaf model)
>W1710727389	Val	TAC
                   c      ACCA ggaagtggcc
                     G - C
                     G - C
                     G - C
                     A - T
                     G - C
                     C - G
                     A - T          C G
                    T     T G T C C     A
      C G A        A      | | | | |     G
    T       C T C G       A C A G G     C
    G       | | | |                 T T
    G       G A G C
      G A          A     GGGTC
                    C - G
                    T - A
                    T - A
                    G - C
                    C - G
                  C       A
                  T       A
                    T A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK