The detailed information of tRNA gene sequence


Sequence ID>W1710735433
Genome IDLGHA01000112
Search identical group
Phylum/ClassChloroflexi
SpeciesAnaerolinaceae bacterium 46_22 (LGHA)
Start position on genome 237
End posion on genome 165
Amino Acid Thr
Anticodon GGT
Upstream region at tRNA start position
cggatcggct
tRNA gene sequence
GCCCTCATAGCTCAGTCGGTAGAGCGCATTCTTGGTAAGAATGAGGTCATGGGTTCAAAT
CCCATTGAGGGCTttc
Downstream region at tRNA end position
tgccgaagta
Secondary structure (Cloverleaf model)
>W1710735433	Thr	GGT
                   t      Tttc tgccgaagta
                     G - C
                     C - G
                     C - G
                     C - G
                     T - A
                     C - G
                     A - T          T A
                    T     T A C C C     A
      T G A        A      | | | | |     A
    C       C T C G       A T G G G     C
    G       | | | |                 T T
    G       G A G C
      T A          G     AGGTC
                    C - G
                    A - T
                    T - A
                    T - A
                    C - G
                  T       A
                  T       A
                    G G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK