Sequence ID | >C000292 |
Genome ID | AM286690 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Alcanivorax borkumensis SK2 [AM286690] |
Start position on genome | 2149218 |
End posion on genome | 2149294 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggcctcaaat |
tRNA gene sequence |
GGCAAGGTAGCTCAGCTGGTTAGAGCACAGCACTCATAATGCTGGGGTCGGCGGTTCAAG |
Downstream region at tRNA end position |
aacaaacaaa |
Secondary structure (Cloverleaf model) | >C000292 Met CAT t ACCA aacaaacaaa G + T G - C C - G A - T A - T G - C G - C T G T C C G C C A C G A A | | | | | A T C T C G G G C G G C G | | | | T T G G A G C T T A A GGGTC C - G A - T G - C C - G A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |