| Sequence ID | >C000922 |
| Genome ID | CP000569 |
| Phylum/Class | Gammaproteobacteria |
| Species | Actinobacillus pleuropneumoniae serovar 5b str. L20 [CP000569] |
| Start position on genome | 71106 |
| End posion on genome | 71181 |
| Amino Acid | Ala |
| Anticodon | TGC |
| Upstream region at tRNA start position |
tatgatgtat |
| tRNA gene sequence |
GGGGATATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGTCAGCGGTTCGATC |
| Downstream region at tRNA end position |
atcatcatga |
| Secondary structure (Cloverleaf model) | >C000922 Ala TGC
t ACCA atcatcatga
G - C
G - C
G + T
G - C
A - T
T - A
A - T C T
T T C G C C A
C G A A | | | | | G
T C T C G A G C G G C
G | | | | T T
G G A G C
G A G AGGTC
C - G
C - G
T - A
G - C
C - G
C C
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |