Sequence ID | >C002935 |
Genome ID | BA000004 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Halalkalibacterium halodurans C-125 [BA000004] |
Start position on genome | 123869 |
End posion on genome | 123957 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aagattctgt |
tRNA gene sequence |
GCCGGGGTGGTGGAATTGGCAGACACACAGGACTTAAAATCCTGCGGTAGGTGACTACCG |
Downstream region at tRNA end position |
gtaacgatct |
Secondary structure (Cloverleaf model) | >C002935 Leu TAA t ACCA gtaacgatct G - C C - G C - G G - C G + T G - C G - C T G T C G G C C A T A A G | | | | | A T G G T G G C C G G C G | | | T T G A C A C C A G A CGGTAGGTGACTACCGT C - G A - T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |