Sequence ID | >C008405 |
Genome ID | CP000247 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli 536 [CP000247] |
Start position on genome | 1035086 |
End posion on genome | 1034999 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gcgtcattcc |
tRNA gene sequence |
GGAAGTGTGGCCGAGCGGTTGAAGGCACCGGTCTTGAAAACCGGCGACCCGAAAGGGTTC |
Downstream region at tRNA end position |
aataagataa |
Secondary structure (Cloverleaf model) | >C008405 Ser TGA c GCCA aataagataa G - C G - C A - T A - T G - C T + G G - C T A T G T C T C A C G A G | | | | | G G G C C G C A G A G C G | | | T T T A G G C T G A A CGACCCGAAAGGGTTC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |