| Sequence ID | >C009454 |
| Genome ID | AE009951 |
| Phylum/Class | Fusobacteriota |
| Species | Fusobacterium nucleatum subsp. nucleatum ATCC 25586 [AE009951] |
| Start position on genome | 755476 |
| End posion on genome | 755401 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
aatgacatta |
| tRNA gene sequence |
GCCGCTTTAGCTCATCTGGTAGAGCAACTGACTTGTAATCAGTAGGTGATTGGTTCGACT |
| Downstream region at tRNA end position |
gtgccccgtt |
| Secondary structure (Cloverleaf model) | >C009454 Thr TGT
a ACCA gtgccccgtt
G - C
C - G
C - G
G - C
C - G
T - A
T - A T C
T T A G C C A
C T A A | | + | | G
T C T C G A T T G G C
G | | | | T T
G G A G C
T A A AGGTG
A - T
C - G
T - A
G - C
A - T
C A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |