Sequence ID | >C009873 |
Genome ID | CU207366 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Christiangramia forsetii KT0803 [CU207366] |
Start position on genome | 1728004 |
End posion on genome | 1728081 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aattattatt |
tRNA gene sequence |
CGGGGTGTAGCGTAGCCCGGTCATCGCGCCTGCTTTGGGAGCAGGAGGTCGCAGGTTCGA |
Downstream region at tRNA end position |
aaagcctgtt |
Secondary structure (Cloverleaf model) | >C009873 Pro TGG t ACTA aaagcctgtt C - G G - C G - C G - C G - C T - A G - C T A T C G T C C A C C G A A | | | | | G C T G C G G C A G G C G | | | T T G T C G C T C A G AGGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |