Sequence ID | >C014833 |
Genome ID | AP006618 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Nocardia farcinica IFM 10152 [AP006618] |
Start position on genome | 5421519 |
End posion on genome | 5421434 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aacggtgaac |
tRNA gene sequence |
GGCAGGTTGCCCGAGCGGCCAATGGGAGCAGACTGTAAATCTGTCGGTGAAAGCCTACGT |
Downstream region at tRNA end position |
atatcgaaaa |
Secondary structure (Cloverleaf model) | >C014833 Tyr GTA c ACCC atatcgaaaa G - C G - C C - G A - T G - C G - C T - A T A T C A T C C A C G A G | | | | | G G G C C C G T A G G C G + | | | T T C T G G G C A A A CGGTGAAAGCCTAC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |