| Sequence ID | >C018430 |
| Genome ID | CP000133 |
| Phylum/Class | Alphaproteobacteria |
| Species | Rhizobium etli CFN 42 [CP000133] |
| Start position on genome | 1682210 |
| End posion on genome | 1682135 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
cgccagcgat |
| tRNA gene sequence |
GGGCGATTAGCTCAGTTGGTAGAGCGCCTCGTTTACACCGAGGATGTCGGGAGTTCGAGT |
| Downstream region at tRNA end position |
tttcttcctt |
| Secondary structure (Cloverleaf model) | >C018430 Val TAC
t ACCA tttcttcctt
G - C
G - C
G - C
C - G
G - C
A - T
T - A T G
T C T C T C A
T G A A | + | | | G
T C T C G G G G A G C
G | | | | T T
G G A G C
T A G ATGTC
C - G
C - G
T - A
C - G
G - C
T C
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |