Sequence ID | >C020616 |
Genome ID | CP000563 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Shewanella baltica OS155 [CP000563] |
Start position on genome | 623857 |
End posion on genome | 623932 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tacagattac |
tRNA gene sequence |
GCGACATTAGCTCAGTTGGTAGAGCGATACCTTGCCAAGGTATAGGTCATCGGTTCGAAC |
Downstream region at tRNA end position |
aattaaaact |
Secondary structure (Cloverleaf model) | >C020616 Gly GCC c TCCA aattaaaact G - C C - G G - C A - T C - G A - T T - A C A T T A G C C A T G A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C T A G AGGTC A - T T - A A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |