Sequence ID | >C020703 |
Genome ID | CP000563 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Shewanella baltica OS155 [CP000563] |
Start position on genome | 2998077 |
End posion on genome | 2997991 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
taaagagttt |
tRNA gene sequence |
GCCCGAGTGGTGGAATCGGTAGACACAAGGGATTTAAAATCCCTCGCTGGTAACAGCGTG |
Downstream region at tRNA end position |
ttatttttga |
Secondary structure (Cloverleaf model) | >C020703 Leu TAA t ACCA ttatttttga G + T C - G C - G C - G G - C A - T G - C T G T C G G T C A T A A G | | | | | A C G G T G G C C A G C G | | | T T G A C A C T A G A CGCTGGTAACAGCGT A - T G - C G - C G - C A - T T A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |