| Sequence ID | >C022214 |
| Genome ID | CP000469 |
| Phylum/Class | Gammaproteobacteria |
| Species | Shewanella sp. ANA-3 [CP000469] |
| Start position on genome | 693125 |
| End posion on genome | 693200 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
acaaaattat |
| tRNA gene sequence |
GCGACATTAGCTCAGTTGGTAGAGCGATACCTTGCCAAGGTATAGGTCATCGGTTCGAAC |
| Downstream region at tRNA end position |
attttctgaa |
| Secondary structure (Cloverleaf model) | >C022214 Gly GCC
t TCCA attttctgaa
G - C
C - G
G - C
A - T
C - G
A - T
T - A C A
T T A G C C A
T G A A | | | | | G
T C T C G A T C G G C
G | | | | T T
G G A G C
T A G AGGTC
A - T
T - A
A - T
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |