Sequence ID | >C022790 |
Genome ID | CP000738 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sinorhizobium medicae WSM419 [CP000738] |
Start position on genome | 232613 |
End posion on genome | 232539 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gccgccggat |
tRNA gene sequence |
GCTGCTATAGCTCAGGGGTAGAGCACTCCCTTGGTAAGGGAGAGGCCGAGAGTTCAAATC |
Downstream region at tRNA end position |
gttttcctct |
Secondary structure (Cloverleaf model) | >C022790 Thr GGT t ACCA gttttcctct G - C C - G T - A G - C C - G T - A A - T T A T C T C T C A G A A | | | | | A G C T C G G A G A G C G | | | | T T G G A G C T A A AGGCC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |