Sequence ID | >C08011505 |
Genome ID | AM920689 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Xanthomonas campestris pv. campestris B100 [AM920689] |
Start position on genome | 3943542 |
End posion on genome | 3943470 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
acgagtacat |
tRNA gene sequence |
ACGCCAGTAGCTCAATTGGCAGAGCAGCGGTCTCCAAAACCGCAGGTTGGGGGTTCGAGT |
Downstream region at tRNA end position |
ctcctctttc |
Secondary structure (Cloverleaf model) | >C08011505 Trp CCA t Gcca ctcctctttc A - T C - G G - C C - G C - G A - T G - C T G T C T C C C A T A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C C A A AGGTT G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |