Sequence ID | >C09104580 |
Genome ID | FM180568 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli O127:H6 str. E2348/69 [FM180568] |
Start position on genome | 2139094 |
End posion on genome | 2139005 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ccatctgaac |
tRNA gene sequence |
GGAGAGATGCCGGAGCGGCTGAACGGACCGGTCTCGAAAACCGGAGTAGGGGCAACTCTA |
Downstream region at tRNA end position |
ctttatcaat |
Secondary structure (Cloverleaf model) | >C09104580 Ser CGA c GCCA ctttatcaat G - C G - C A - T G - C A - T G - C A - T T A T C C C C C A C G A G | | | | | A G G G C C G G G G G C G | | | T T C A C G G T G A A AGTAGGGGCAACTCTACC C - G C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |