Sequence ID | >C09107841 |
Genome ID | CP001349 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Methylobacterium nodulans ORS 2060 [CP001349] |
Start position on genome | 4916230 |
End posion on genome | 4916305 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
atcgccgcgc |
tRNA gene sequence |
GGGGCTGTAGCTCAGTTGGGAGAGCGCGTGCTTTGCAAGCATGAGGTCGTCGGTTCGATC |
Downstream region at tRNA end position |
ctctcctctc |
Secondary structure (Cloverleaf model) | >C09107841 Ala TGC c ACCA ctctcctctc G - C G - C G + T G - C C - G T - A G - C C T T C T G C C A T G A A | | | | G T C T C G G T C G G C G | | | | T T G G A G C G A G AGGTC C - G G + T T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |