Sequence ID | >C09108928 |
Genome ID | AP011115 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Rhodococcus opacus B4 [AP011115] |
Start position on genome | 5357107 |
End posion on genome | 5357183 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
aggaaagcaa |
tRNA gene sequence |
GGCCCTGTGGCGCAGTTGGTTAGCGCGCCGCCCTGTCACGGCGGAGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
gtatgttgcc |
Secondary structure (Cloverleaf model) | >C09108928 Asp GTC a GCAA gtatgttgcc G - C G + T C - G C - G C - G T - A G - C T G T T G C C C A T G A G + | | | | G T C G C G G C G G G C G | | | | T T G G C G C T T A G AGGTC C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |