Sequence ID | >C10108536 |
Genome ID | CP001834 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lactococcus lactis subsp. lactis KF147 [CP001834] |
Start position on genome | 1208260 |
End posion on genome | 1208333 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atagttaaaa |
tRNA gene sequence |
AGTGGGATGGAGCAGTTAGGTAGCTCGTCGGGCTCATAACCCGAAGGTCATAGGTTCAAA |
Downstream region at tRNA end position |
tttaagggct |
Secondary structure (Cloverleaf model) | >C10108536 Met CAT a Atat tttaagggct A A G - C T + G G - C G - C G - C A - T T A T T A T C C A T G A G | | | | | A T C G A G A T A G G C A | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |