| Sequence ID | >C11109627 |
| Genome ID | CP002442 |
| Phylum/Class | Bacillota |
| Species | Geobacillus sp. Y412MC52 [CP002442] |
| Start position on genome | 240587 |
| End posion on genome | 240661 |
| Amino Acid | Asn |
| Anticodon | GTT |
| Upstream region at tRNA start position |
ttctcatcat |
| tRNA gene sequence |
TCCGCAATAGCTCAGCGGTAGAGCAACCGGCTGTTAACCGGTAGGTCGTAGGTTCGAATC |
| Downstream region at tRNA end position |
tttctttgga |
| Secondary structure (Cloverleaf model) | >C11109627 Asn GTT
t GCCA tttctttgga
T - A
C - G
C - G
G - C
C - G
A - T
A - T T A
T C A T C C A
G A A | | | | | G
C C T C G G T A G G C
G | | | | T T
G G A G C
T A A AGGTC
A - T
C - G
C - G
G - C
G - C
C A
T A
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |