Sequence ID | >C11112753 |
Genome ID | AP009333 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lactococcus garvieae Lg2 [AP009333] |
Start position on genome | 1936437 |
End posion on genome | 1936365 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gttgagagaa |
tRNA gene sequence |
GGGGCCTTAGCTCAGCTGGGAGAGCGCCTGCTTTGCACGCAGGAGGTCAGCGGTTCGATC |
Downstream region at tRNA end position |
gatacggaag |
Secondary structure (Cloverleaf model) | >C11112753 Ala TGC a Ataa gatacggaag G - C G - C G + T G - C C - G C - G T - A C T T T C G C C A C G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G T C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |