| Sequence ID | >C11120027 |
| Genome ID | CP002614 |
| Phylum/Class | Gammaproteobacteria |
| Species | Salmonella enterica subsp. enterica serovar Typhimurium str. UK-1 [CP002614] |
| Start position on genome | 2330499 |
| End posion on genome | 2330575 |
| Amino Acid | Pro |
| Anticodon | GGG |
| Upstream region at tRNA start position |
acccacaagt |
| tRNA gene sequence |
CGGCACGTAGCGCAGCCTGGTAGCGCACCGTCATGGGGTGTCGGGGGTCGGAGGTTCAAA |
| Downstream region at tRNA end position |
aaattcctcg |
| Secondary structure (Cloverleaf model) | >C11120027 Pro GGG
t ACCA aaattcctcg
C - G
G - C
G - C
C - G
A - T
C - G
G - C T A
T T C T C C A
C G A A + | | | | A
C C G C G G G A G G C
T | | | | T T
G G C G C
G T A A GGGTC
C - G
C - G
G - C
T T
C - G
A T
T G
G G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |