Sequence ID | >C121005225 |
Genome ID | CP003075 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Pelagibacterium halotolerans B2 [CP003075] |
Start position on genome | 76037 |
End posion on genome | 76113 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ccggcactgc |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCACCAGACTACGAATCTGGGGGTCAGAGGTTCGAA |
Downstream region at tRNA end position |
ttttttcgct |
Secondary structure (Cloverleaf model) | >C121005225 Arg ACG c GCCA ttttttcgct G - C C - G G - C C - G C - G C - G G - C T A T T T T C C A C G A A | + | | | G T C T C G A G A G G C G | | | | T T G G A G C A T A A GGGTC C - G C - G A - T G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |