Sequence ID | >C121012795 |
Genome ID | CP003416 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Salmonella enterica subsp. enterica serovar Heidelberg str. B182 [CP003416] |
Start position on genome | 1520218 |
End posion on genome | 1520142 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gaaatcatct |
tRNA gene sequence |
GGCTACGTAGCTCAGTTGGTTAGAGCACATCACTCATAATGATGGGGTCACAGGTTCGAA |
Downstream region at tRNA end position |
tattcagaac |
Secondary structure (Cloverleaf model) | >C121012795 Met CAT t ACCA tattcagaac G - C G - C C - G T - A A - T C - G G - C T A T T G C C C A T G A A | | | | G T C T C G A C A G G C G | | | | T T G G A G C T T A A GGGTC C - G A - T T - A C - G A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |