Sequence ID | >C131001166 |
Genome ID | CP001845 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Streptococcus pneumoniae gamPNI0373 [CP001845] |
Start position on genome | 1726900 |
End posion on genome | 1726827 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atattattaa |
tRNA gene sequence |
CGCGGGATGGAGCAGCTCGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
ggctcggtag |
Secondary structure (Cloverleaf model) | >C131001166 Met CAT a Ataa ggctcggtag C A G - C C - G G - C G - C G - C A - T T A T C G T C C A C G A G | + | | | A T C G A G G T A G G C C | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |