Sequence ID | >C131004511 |
Genome ID | CP003597 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Chroococcidiopsis thermalis PCC 7203 [CP003597] |
Start position on genome | 2728821 |
End posion on genome | 2728894 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
agctgtgaaa |
tRNA gene sequence |
CGGGGCGTAGCGCAGCTTGGTAGCGCGCCACTTTGGGGTAGTGGAGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
aatcaaatcc |
Secondary structure (Cloverleaf model) | >C131004511 Pro GGG a Attt aatcaaatcc C - G G - C G - C G + T G - C C - G G - C T A T C G C C C A C G A A | + | | | G T C G C G G T G G G C T | | | | T T G G C G C G T A G AGGTC C - G C - G A - T C - G T - A T T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |