| Sequence ID | >C131010331 |
| Genome ID | CP003943 |
| Phylum/Class | Cyanobacteriota |
| Species | Calothrix sp. PCC 7507 [CP003943] |
| Start position on genome | 5193449 |
| End posion on genome | 5193377 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
cttgactaac |
| tRNA gene sequence |
GCGATCATGGTGTAGTGGTAAACACCCTTGGCTTCCAACCAGGAGACACGAGTTCAAATC |
| Downstream region at tRNA end position |
aaccctcaag |
| Secondary structure (Cloverleaf model) | >C131010331 Gly TCC
c TCtg aaccctcaag
G - C
C - G
G - C
A - T
T - A
C - G
A - T T A
T T G C T C A
T G A G | | | | | A
G T G T G A C G A G C
G | | | | T T
T A C A C
A A C AGAC
C - G
T + G
T - A
G - C
G - C
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |