Sequence ID | >C131011232 |
Genome ID | CP004008 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Geobacillus sp. GHH01 [CP004008] |
Start position on genome | 2986941 |
End posion on genome | 2986866 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
acttcttcgt |
tRNA gene sequence |
GGAGGATTAGCTCAGCTGGGAGAGCACTTGCCTTACAAGCAAGGGGTCGGCGGTTCGATC |
Downstream region at tRNA end position |
ttatttgcaa |
Secondary structure (Cloverleaf model) | >C131011232 Val TAC t ACCA ttatttgcaa G - C G - C A - T G - C G - C A - T T - A C T T C T G C C A C G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C G A A GGGTC C - G T - A T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |