Sequence ID | >C131018788 |
Genome ID | HE579069 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Staphylococcus aureus subsp. aureus ST228 [HE579069] |
Start position on genome | 1895459 |
End posion on genome | 1895377 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
caccatttaT |
tRNA gene sequence |
GGAGGGGTAGCGAAGTGGCTAAACGCGGCGGACTGTAAATCCGCTCCTTCGGGTTCGGCA |
Downstream region at tRNA end position |
attattttta |
Secondary structure (Cloverleaf model) | >C131018788 Tyr GTA T ATtt attattttta G - C G - C A - T G - C G - C G - C G - C T A T C C G T C A T G A A | | | | | G G A G C G G G C A G C G | | | T T C A C G C T A A G TCCTTCGGGTTC G - C C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |